Taxon Name
Brettanomyces bruxellensis Kuff. & Van Laer
Accession number
6706
Form of supply
agar slant
Synonymous
Dekkera bruxellensis van der Walt, Brettanomyces bruxellensis var. bruxellensis , Brettanomyces lambicus Kuff. & Van Laer, Mycotorula intermedia Krumbholz & Tauschan., Brettanomyces bruxellensis var. non-membranaefaciens Custers, Brettanomyces custersii F
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 36234; CBS 74; CCRC 21414; IFO 1590; NCYC 823; NRRL Y-12961
Risk Group
1
GMO
No
Status of the strain
Isotype of Dekkera bruxellensis Van der Walt
Isolation source
sediment in lambic beer
Isolation Locality
BEL – Belgium
Received from
David Yarrow – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
18/09/1990
LSU (D1/D2)
GenBank U45738; Brettanomyces_bruxellensis_DBVPG6706_D1D2 AATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTATAGCGCGGACATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTGA
18S rRNA
GenBank EF550395
ITS1&2
GenBank AF043501; Brettanomyces_bruxellensis_DBVPG6706_ITS
GATAAAAATACATTAAATTTATTTTAGTTTAGTCAAGAAAGAATTTTAAAACTYTTCAAC
AATGGATCTCTTGGTTCTCGCGTCGATGAAGAGCGCAGCGAATTGCGATACTTAATGTGA
ATTGCAGATTTTCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCTCTGGTATTCCG
GAGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCACTATTTAGTGGTTATGAGATTACAC
GAGGGTGTTTTCTTCAAAGGAAAGAGGGGAGAGTGAGGGGATAATGATTTAAGGTTTCGG
CCGTTCATTATTTTTTTCTTCTCCCCCAGTTATCAAGTTTGACCTCAAATCAGGTAGGAG
GACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCC
AGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATT
TGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAG
AGGGTGAGAGCCCCGTGAATCGCTGGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAG
TTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGA
GAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTG
AAATAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGC
GGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGT
Recommended growth temperature
25°C
Recommended growth medium
YPDA+CaCO3 (Yeast Extract Peptone Glucose Agar with addition of CaCO3)
Jpapers
DOI Number: 10.1002/yea.320060403
Title: Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology
Authors: Smith et al.
Journal: Yeast
Year: 1990
Title: Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology
Authors: Smith et al.
Journal: Yeast
Year: 1990
DOI Number: 10.1006/fmic.1998.0217
Title: Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods
Authors: Mitrakul et al.
Journal: Food Microbiol.
Year: 1999
Title: Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods
Authors: Mitrakul et al.
Journal: Food Microbiol.
Year: 1999
DOI Number: 10.1007/BF00160482
Title: Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order
Authors: Hoeben et al.
Journal: J.Mol.Evol.
Year: 1993
Title: Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order
Authors: Hoeben et al.
Journal: J.Mol.Evol.
Year: 1993
DOI Number: 10.1007/BF00365677
Title: Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts
Authors: McArthur, Clark-Walker
Journal: Curr.Genet
Year: 1983
Title: Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts
Authors: McArthur, Clark-Walker
Journal: Curr.Genet
Year: 1983
DOI Number: 10.1007/BF02046733
Title: Dekkera, a new genus of the Saccharomycetaceae
Authors: van der Walt
Journal: A.v.Leeuwenhoek
Year: 1964
Title: Dekkera, a new genus of the Saccharomycetaceae
Authors: van der Walt
Journal: A.v.Leeuwenhoek
Year: 1964
DOI Number: 10.1016/j.ijfoodmicro.2009.02.013
Title: In vitro antimycotic activity of a Williopsis saturnus killer protein against food spoilage yeasts
Authors: Goretti et al.
Journal: Int.J.Food Microbiol.
Year: 2009
Title: In vitro antimycotic activity of a Williopsis saturnus killer protein against food spoilage yeasts
Authors: Goretti et al.
Journal: Int.J.Food Microbiol.
Year: 2009
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
DOI Number: 10.1271/bbb.58.1803
Title: The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Title: The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
