Taxon Name
Brettanomyces naardenensis Kolfschoten & Yarrow
Accession number
6712
Form of supply
agar slant
Synonymous
Dekkera naardenensis S.C. Jong & F.L. Lee
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22075; CBS 6042; CCRC 21520; IFO 1588; NRRL Y-17526
Risk Group
1
GMO
No
Status of the strain
Isotype of Dekkera naardenensis S.C. Jong & F.L. Lee; Isotype of Brettanomyces naardenensis Kolfschoten & Yarrow
Isolation source
lemonade
Isolation Locality
NLD – The Netherlands
Received from
David Yarrow – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
18/09/1990
LSU (D1/D2)
GenBank U76200; Brettanomyces_naardenensis DBVPG6712_D1D2 GCGGCAAAAGCTCGAATTTGAAATCCTCTTCGGAGGAGTTGTAATTTGAAGCTGGTTCTT
TAGGGAGTTTTGTTTTTGGCTGCGGAAGTGCCTTGGAACAGGCCGCCGTGGAGGGTGAGA
GCCCCGTATCGTGGCCAGCAAGATTTTCGTATAAGGGCTAGCGAAGAGTCGAGTTGTTTG
GGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATGGGCGAGAGACCG
ATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGT
ACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTATTTAGATGTCGCTTGC
CCCCGTGGCGGGCGCTCCATCTTTTTACTGGGCCAGCATCGGTGCTGGGCGGGACAGGAG
GTTTCTGTGAATGTAGCCCTTCGGGGAACTTATAGAACAGGATTCATACGTCTCTCCCCG
GTACCGAGGACTGCGGGAAACCAAGGATGCTGGCATAACGAGCAAATACCGCCCGTCTTG
A
18S rRNA
GenBank X85110
ITS1&2
GenBank AF043512
Recommended growth temperature
25°C
Recommended growth medium
YPDA+CaCO3 (Yeast Extract Peptone Glucose Agar with addition of CaCO3)
Jpapers
DOI Number: 10.1002/yea.320060403
Title: Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology
Authors: Smith et al.
Journal: Yeast
Year: 1990
Title: Dekkera, Brettanomyces and Eeniella: Electrophoretic comparison of enzymes and DNA–DNA homology
Authors: Smith et al.
Journal: Yeast
Year: 1990
DOI Number: 10.1006/fmic.1998.0217
Title: Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods
Authors: Mitrakul et al.
Journal: Food Microbiol.
Year: 1999
Title: Discrimination of Brettanomyces/Dekkera yeast isolates from wine by using various DNA finger-printing methods
Authors: Mitrakul et al.
Journal: Food Microbiol.
Year: 1999
DOI Number: 10.1007/BF00160482
Title: Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order
Authors: Hoeben et al.
Journal: J.Mol.Evol.
Year: 1993
Title: Larger rearranged mitochondrial genomes in Dekkera/Brettanomyces yeasts are more closely related than smaller genomes with a conserved gene order
Authors: Hoeben et al.
Journal: J.Mol.Evol.
Year: 1993
DOI Number: 10.1007/BF00365677
Title: Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts
Authors: McArthur, Clark-Walker
Journal: Curr.Genet
Year: 1983
Title: Mitochondrial DNA size diversity in the Dekkera/Brettanomyces yeasts
Authors: McArthur, Clark-Walker
Journal: Curr.Genet
Year: 1983
DOI Number: 10.1007/BF02069047
Title: Brettanomyces naardenensis, a new yeast from soft drinks
Authors: Kolfschoten, Yarrow
Journal: A.v.Leeuwenhoek
Year: 1970
Title: Brettanomyces naardenensis, a new yeast from soft drinks
Authors: Kolfschoten, Yarrow
Journal: A.v.Leeuwenhoek
Year: 1970
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-46-2-542
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
Title: Phylogenetic Relationships among Members of the Ascomycetous Yeast Genera Brettanomyces, Debaryomyces, Dekkera, and Kluyveromyces Deduced by Small-Subunit rRNA Gene Sequences
Authors: Cai et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1996
DOI Number: 10.1271/bbb.58.1803
Title: The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Title: The Phylogenetic Relationships of Species of the Genus Dekkera van der Walt Based on the Partial Sequences of 18S and 26S Ribosomal RNAs (Saccharomycetaceae)
Authors: Yamada et al.
Journal: Biosci.Biotechnol.Biochem.
Year: 1995
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
