Taxon Name
Kazachstania spencerorum (Vaughan-Martini) Kurtzman
Accession number
6746
Form of supply
agar slant
Synonymous
Saccharomyces spencerorum Vaughan-Martini
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 3019; IFO 1617; NRRL Y-17920; VKPM Y 1487
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces spencerorum Vaughan-Martini
Isolation source
soil
Isolation Locality
ZAF – South Africa
Received from
Date of deposit
12/02/1992
LSU (D1/D2)
GenBank U84227; Kazachstania_spencerorum_DBVPG6746_D1D2
AGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTTGGTGCTCGAGTTGTAATTTGTAGA
GGGATACTTTTGGGCCGTTCCTTATCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGA
GAATCCCGTATGATGAGGAGTGCGGTTCTATGTAAAGTGCTCTCGAAGAGTCGAGTTGTT
TGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAC
CGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAA
GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTG
CTCCTTGTGGGTAGGGGACTCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGA
TAAATCCTTTGGAATGTAGCTTGCTTCGGGAAGTGTTATAGCCAAGGGGAATACTGCCAG
CTGGGATTGAGGACTGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCC
18S rRNA
GenBank X97807
ITS1&2
GenBank AY046161
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Pheromone activity of collection strains of Saccharomyces sensu lato yeasts
Authors: Naumov, Piskur
Journal: Microbiology
Year: 1999
Authors: Naumov, Piskur
Journal: Microbiology
Year: 1999
DOI Number: 10.1007/BF00873098
Title: Saccharomyces barnetti and Saccharomyces spencerorum: two new species of Saccharomyces sensu lato (van der Walt)
Authors: Vaughan-Martini
Journal: A.v.Leeuwenhoek
Year: 1995
Title: Saccharomyces barnetti and Saccharomyces spencerorum: two new species of Saccharomyces sensu lato (van der Walt)
Authors: Vaughan-Martini
Journal: A.v.Leeuwenhoek
Year: 1995
DOI Number: 10.1016/j.biortech.2010.12.062
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
Title: Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells
Authors: Goretti et al.
Journal: Biores.Technol.
Year: 2011
DOI Number: 10.1016/j.enzmictec.2009.09.004
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
Title: Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases
Authors: Goretti et al.
Journal: Enzyme Microb.Tech.
Year: 2009
DOI Number: 10.1016/j.mimet.2010.09.007
Title: Rapid method for screening enoate reductase activity in yeasts
Authors: Raimondi et al.
Journal: J.Microbiol.Methods.
Year: 2010
Title: Rapid method for screening enoate reductase activity in yeasts
Authors: Raimondi et al.
Journal: J.Microbiol.Methods.
Year: 2010
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1099/00207713-47-2-453
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
Title: A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.
Authors: James et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1997
DOI Number: 10.1099/00207713-49-1-319
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Title: Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker
Authors: Steels et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1999
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
