Taxon Name
Kazachstania spencerorum (Vaughan-Martini) Kurtzman
Accession number
6746
Form of supply
agar slant
Synonymous
Saccharomyces spencerorum Vaughan-Martini
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
CBS 3019; IFO 1617; NRRL Y-17920; VKPM Y 1487
Risk Group
1
GMO
No
Status of the strain
Isotype of Saccharomyces spencerorum Vaughan-Martini
Isolation source
soil
Isolation Locality
ZAF – South Africa
Received from
CBS, Delft, The Netherlands
Date of deposit
12/02/1992
LSU (D1/D2)
GenBank U84227; Kazachstania_spencerorum_DBVPG6746_D1D2
AGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTTGGTGCTCGAGTTGTAATTTGTAGA
GGGATACTTTTGGGCCGTTCCTTATCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGA
GAATCCCGTATGATGAGGAGTGCGGTTCTATGTAAAGTGCTCTCGAAGAGTCGAGTTGTT
TGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGAC
CGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAA
GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTG
CTCCTTGTGGGTAGGGGACTCTCGCAGTTCACTGGGCCAGCATCAGTTTTGGCGGCAGGA
TAAATCCTTTGGAATGTAGCTTGCTTCGGGAAGTGTTATAGCCAAGGGGAATACTGCCAG
CTGGGATTGAGGACTGCGACTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGCCC
18S rRNA
GenBank X97807
ITS1&2
GenBank AY046161
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Vaughan-Martini. Saccharomyces barnetti and Saccharomyces spencerorum: two new species of Saccharomyces sensu lato (van der Walt). A.v.Leeuwenhoek (1995), 68: 111-118 DOI: 10.1007/BF00873098
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Raimondi et al.. Rapid method for screening enoate reductase activity in yeasts. J.Microbiol.Methods (2010), 83: 106-110 DOI: 10.1016/j.mimet.2010.09.007
Naumov, Piskur. Pheromone activity of collection strains of Saccharomyces sensu lato yeasts. Microbiology (1999), 68: 759-762
Goretti et al.. Bioreduction of α,β-unsaturated ketones and aldehydes by non-conventional yeast (NCY) whole-cells. Biores.Technol. (2011), 102: 3993-3998 DOI: 10.1016/j.biortech.2010.12.062
Goretti et al.. Biotransformation of electron-poor alkenes by yeasts: Asymmetric reduction of (4S)-(+)-carvone by yeast enoate reductases. Enzyme Microb.Tech. (2009), 45: 463-468 DOI: 10.1016/j.enzmictec.2009.09.004
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
James et al.. A phylogenetic analysis of the genus Saccharomyces based on 18D rRNA gene sequences: Description of Saccharomyces kunashirensis sp. nov. and Saccharomyces martiniae sp. nov.. Int.J.Syst.Bacteriol. (1997), 47: 453-460 DOI: 10.1099/00207713-47-2-453
Steels et al.. Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. Int.J.Syst.Bacteriol. (1999), 49: 319-327 DOI: 10.1099/00207713-49-1-319
Raimondi et al.. Rapid method for screening enoate reductase activity in yeasts. J.Microbiol.Methods (2010), 83: 106-110 DOI: 10.1016/j.mimet.2010.09.007
Naumov, Piskur. Pheromone activity of collection strains of Saccharomyces sensu lato yeasts. Microbiology (1999), 68: 759-762
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito