Taxon Name
Hanseniaspora guilliermondii Pijper
Accession number
6796
Form of supply
agar slant
Synonymous
Acaromyces laviae Lavie, Willia guilliermondii (Pijper) Vuillemin, Hanseniaspora apuliensis Castelli, Hanseniaspora melligeri Lodder, Kloeckera apiculata (Reess) Janke var. apis Lavie, Kloeckera apis Lavie ex M.T. Smith et al.
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 10630; ATCC 58435; CBS 465; CCRC 22105; IFO 1411; NRRL Y-1625
Risk Group
1
GMO
No
Status of the strain
Isotype of Hanseniaspora guilliermondii Pijper
Isolation source
infected finger nail
Isolation Locality
ZAF – South Africa
Received from
David Yarrow – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
02/02/1993
LSU (D1/D2)
GenBank U84230
18S rRNA
GenBank AY046256
ITS1&2
GenBank AJ512433; Hanseniaspora_guilliermondii_DBVPG6796_ITS
GCTGCTTCTTTAAAGTGTCGCAGTAGAAGTAATCTTGCTTGAATCTCAGTCAACGTTTAC
ACACATTGGAGTTTTTTTACTTTAATATAATTCTTTCTGCTTTGAATCGAAAGGTTCAAG
GCAAAAAACAAACACAAACAATTTTATTTTATTATAATTTTTTAAACTAAACCAAAATTC
CTAACGGAAATTTTAAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATC
GATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTG
AATTTTTGAACGCACATTGCGCCCTTGAGCATTCTCAAGGGCATGCCTGTTTGAGCGTCA
TTTCCTTCTCAAAAGATAATTTTTTATTTTTTGGTTGTGGGCGATACTCAGGGTTAGCTT
GAAATTGAAGATTGTTTCAATCTTTTTTAATTCAACACTTAGCTTCTTTGGAGACGCTGT
TCTCGCTGTGATGTATTTATGAATTTATTCGTTTTACTTTACAAGGGAAATGGTAATGTA
CCTTAGGCAAAGGGTTGCTTTTAATATTCATCAAGTTTGACCTCAAATCAGGTAGGATTA
CCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
DOI Number: 10.1016/S1567-1356(03)00012-6
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
Title: Phylogenetic relationships among yeasts of the Saccharomyces complex determined from multigene sequence analyses
Authors: Kurtzman, Robnett
Journal: FEMS Yeast Res.
Year: 2003
DOI Number: 10.1023/A:1001761008817
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit (26S) ribosomal DNA partial sequences
Authors: Kurtzman, Robnett
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1046/j.1365-2672.1999.00505.x
Title: Selective sugar consumption by apiculate yeasts
Authors: Ciani, Fatichenti
Journal: Lett.Appl.Microbiol.
Year: 1999
Title: Selective sugar consumption by apiculate yeasts
Authors: Ciani, Fatichenti
Journal: Lett.Appl.Microbiol.
Year: 1999
DOI Number: 10.1099/ijs.0.02618-0
Title: Hanseniaspora meyeri sp. nov. Hanseniaspora clermontiae sp. nov., Hanseniaspora lachancei sp. nov. and Hanseniaspora opuntiae sp. nov., novel apiculate yeast species
Authors: Cadez et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2003
Title: Hanseniaspora meyeri sp. nov. Hanseniaspora clermontiae sp. nov., Hanseniaspora lachancei sp. nov. and Hanseniaspora opuntiae sp. nov., novel apiculate yeast species
Authors: Cadez et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2003
DOI Number: 10.1099/ijs.0.64052-0
Title: Phylogenetic placement of Hanseniaspora-Kloeckera species using multigene sequence analysis with taxonomic implications: Descriptions of Hanseniaspora pseudoguilliermondii sp. nov. and Hanseniaspora occidentalis var. citrica var. nov
Authors: Cadez et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2006
Title: Phylogenetic placement of Hanseniaspora-Kloeckera species using multigene sequence analysis with taxonomic implications: Descriptions of Hanseniaspora pseudoguilliermondii sp. nov. and Hanseniaspora occidentalis var. citrica var. nov
Authors: Cadez et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2006
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
