Taxon Name
Starmerella bombicola Rosa & Lachance
Accession number
6870
Form of supply
agar slant
Synonymous
Candida bombicola (J.F.T. Spencer et al.) S.A. Meyer & Yarrow, Torulopsis bombicola J.F.T. Spencer et al.
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22214; CBS 6009; CCRC 21323; CCRC 22302; IFO 1449; IFO 10243; JCM 9596; NRIC 1806; NRRL Y-17069; DSMZ 27465
Risk Group
1
GMO
No
Status of the strain
Isotype of Starmerella bombicola Rosa & Lachance, Isotype of Torulopsis bombicola J.F.T. Spencer et al.
Isolation source
honey of Bombus sp.
Isolation Locality
CAN – Canada – Alberta – Pincher Creek
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
01/06/1994
LSU (D1/D2)
Starmerella_bombicola_DBVPG6870_D1D2 GTACGGCGAGTGAACAGGCAAAAGCTCAGATTTGAAAGCCTCTCGGGGCATTGTATTCTG
AAGCCTTGATTCTGAGAACCGGTACCTAAGTCTTCTGGAAAGGAGCGCCAAGGAGGGTGA
TAGCCCCGTACGGTACTGACCTCATTGTAGAATCTTGGCGTGGAGTCGAGTTGTTTGGGA
ATGCAGCTCAAATGGGTGGTATGCTCCATCTAAAGCTAAATATCTGCGAGAGACCGATAG
CGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGT
GAAATTGTTGAAATGGAAGGATAGGCCGCTAACCACGTAGAGCCGTGTCTGAGGGGAGGA
TAAAAGCTGTAGAATGTGGCTCTTCGGAGTGTTATAGCTACAGTGCATACTCCCACTCGG
GCGCGAGGACCTAAGGCTCTGCTAAATGGTGGTCTATCACCCGTCTTGA
18S rRNA
GenBank AB013558
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Spencer et al.. Torulopsis bombicola sp. n.. A.v.Leeuwenhoek (1970), 36: 129-133 DOI: 10.1007/BF02069014
Davila et al.. Kinetics and balance of a fermentation free from product inhibition: sophorose lipid production by Candida bombicola. Appl.Microbiol.Biotechnol. (1992), 38: 6-11 DOI: 10.1007/BF00169410
Baccile et al.. Sophorolipids: a yeast-derived glycolipid as greener structure directing agents for self-assembled nanomaterials. Green Chem. (2010), 12: 1564-1567 DOI: 10.1039/C0GC00163E
Lee et al.. Candida galacta comb. nov., a New Combination for Candida apis var. galacta. Int.J.Syst.Bacteriol. (1993), 43: 183-184 DOI: 10.1099/00207713-43-1-183
Rosa, Lachance. The yeast genus Starmerella gen. nov. and Starmerella bombicola sp. nov., the teleomorph of Candida bombicola (Spencer, Gorin & Tullock) Meyer & Yarrow. Int.J.Syst.Bacteriol. (1998), 48: 1413-1417 DOI: 10.1099/00207713-48-4-1413
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Sugita, Nakase. Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida. Syst.Appl.Microbiol. (1999), 22: 79-86 DOI: 10.1016/S0723-2020(99)80030-7
Davila et al.. Kinetics and balance of a fermentation free from product inhibition: sophorose lipid production by Candida bombicola. Appl.Microbiol.Biotechnol. (1992), 38: 6-11 DOI: 10.1007/BF00169410
Baccile et al.. Sophorolipids: a yeast-derived glycolipid as greener structure directing agents for self-assembled nanomaterials. Green Chem. (2010), 12: 1564-1567 DOI: 10.1039/C0GC00163E
Lee et al.. Candida galacta comb. nov., a New Combination for Candida apis var. galacta. Int.J.Syst.Bacteriol. (1993), 43: 183-184 DOI: 10.1099/00207713-43-1-183
Rosa, Lachance. The yeast genus Starmerella gen. nov. and Starmerella bombicola sp. nov., the teleomorph of Candida bombicola (Spencer, Gorin & Tullock) Meyer & Yarrow. Int.J.Syst.Bacteriol. (1998), 48: 1413-1417 DOI: 10.1099/00207713-48-4-1413
Kurtzman, Robnett. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene. J.Clin.Microbiol. (1997), 35: 1216-1223 DOI: 10.1128/jcm.35.5.1216-1223.1997
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Sugita, Nakase. Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida. Syst.Appl.Microbiol. (1999), 22: 79-86 DOI: 10.1016/S0723-2020(99)80030-7
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito