Lievito - DBVPG

Taxon Name

Starmerella bombicola Rosa & Lachance

Accession number

6870

Form of supply

agar slant

Synonymous

Candida bombicola (J.F.T. Spencer et al.) S.A. Meyer & Yarrow, Torulopsis bombicola J.F.T. Spencer et al.

Restrictions on use

For research use only

Nagoya protocol compliance conditions

Not under the scope of the CBD and the Nagoya protocol

Other Collections numbers

ATCC 22214; CBS 6009; CCRC 21323; CCRC 22302; IFO 1449; IFO 10243; JCM 9596; NRIC 1806; NRRL Y-17069; DSMZ 27465

Risk Group

1

GMO

No

Status of the strain

Isotype of Starmerella bombicola Rosa & Lachance, Isotype of Torulopsis bombicola J.F.T. Spencer et al.

Isolation source

honey of Bombus sp.

Isolation Locality

CAN – Canada – Alberta – Pincher Creek

Received from

Cletus Kurtzman – USA – United States Department of Agriculture (USDA) & ARS Culture Collection (NRRL) – Peoria, Illinois
Cletus P. Kurtzman – USA – United States Department of Agriculture (USDA) – Peoria, Illinois

Date of deposit

01/06/1994

LSU (D1/D2)

Starmerella_bombicola_DBVPG6870_D1D2 GTACGGCGAGTGAACAGGCAAAAGCTCAGATTTGAAAGCCTCTCGGGGCATTGTATTCTG AAGCCTTGATTCTGAGAACCGGTACCTAAGTCTTCTGGAAAGGAGCGCCAAGGAGGGTGA TAGCCCCGTACGGTACTGACCTCATTGTAGAATCTTGGCGTGGAGTCGAGTTGTTTGGGA ATGCAGCTCAAATGGGTGGTATGCTCCATCTAAAGCTAAATATCTGCGAGAGACCGATAG CGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGT GAAATTGTTGAAATGGAAGGATAGGCCGCTAACCACGTAGAGCCGTGTCTGAGGGGAGGA TAAAAGCTGTAGAATGTGGCTCTTCGGAGTGTTATAGCTACAGTGCATACTCCCACTCGG GCGCGAGGACCTAAGGCTCTGCTAAATGGTGGTCTATCACCCGTCTTGA

18S rRNA

GenBank AB013558

Recommended growth temperature

25°C

Recommended growth medium

YPDA (Yeast Extract Peptone Glucose Agar)

Jpapers

Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998

DOI Number: 10.1007/BF00169410
Title: Kinetics and balance of a fermentation free from product inhibition: sophorose lipid production by Candida bombicola
Authors: Davila et al.
Journal: Appl.Microbiol.Biotechnol.
Year: 1992

DOI Number: 10.1007/BF02069014
Title: Torulopsis bombicola sp. n.
Authors: Spencer et al.
Journal: A.v.Leeuwenhoek
Year: 1970

DOI Number: 10.1016/S0723-2020(99)80030-7
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999

DOI Number: 10.1039/C0GC00163E
Title: Sophorolipids: a yeast-derived glycolipid as greener structure directing agents for self-assembled nanomaterials
Authors: Baccile et al.
Journal: Green Chem.
Year: 2010

DOI Number: 10.1099/00207713-43-1-183
Title: Candida galacta comb. nov., a New Combination for Candida apis var. galacta
Authors: Lee et al.
Journal: Int.J.Syst.Bacteriol.
Year: 1994

DOI Number: 10.1099/00207713-48-4-1413
Title: The yeast genus Starmerella gen. nov. and Starmerella bombicola sp. nov., the teleomorph of Candida bombicola (Spencer, Gorin & Tullock) Meyer & Yarrow
Authors: Rosa, Lachance
Journal: Int.J.Syst.Bacteriol.
Year: 1998

DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997

Scheda lievito

Richiedi informazioni