Taxon Name
Maudiozyma humilis (E.E. Nel & Van der Walt) Q.M. Wang, Yurkov & Boekhout
Accession number
7219
Form of supply
agar slant
Synonymous
Kazachstania humilis (E.E. Nel & Van der Walt) Jacques, Sarilar & Casaregola, Torulopsis humilis E.E. Nel & Van der Walt, Candida milleri Yarrow, Torulopsis acidi-lactici Nakase et al., Torulopsis holmii (A. Jörgensen) Lodder var. acidi-lactici C. Ramírez & Sierra; Candida humilis (E.E. Nel & van der Walt) S.A. Meyer & Yarrow; Candida milleri Yarrow
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22992; CBS 5658; CCRC 21626; IFO 10280; JCM 9852; NRRL Y-17074
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis humilis Nel & Van der Walt
Isolation source
Bantu beer
Isolation Locality
ZAF – South Africa
Received from
Kurtzman – NRRL, Peoria, IL, USA
Date of deposit
09/12/1999
LSU (D1/D2)
GenBank AF399778; Maudiozyma_humilis_DBVPG7219_D1D2
AATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAGGGCGACTTTGGGGCGGCTCCT
TGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTG
CGGTTCCGTGTAAAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGG
TGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGA
TGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGG
AAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCCCGCTCCTTGTGGGTGGGGGACTCT
CGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCCGGACAAAACTGCAGGAACGTAGCTT
GCTTCGGGAAGTGTTACAGCCTGCAGGAATACGGCCAGCCGGGACTGAGGAATGCGATTC
GTCAAGGATGCTGGCATAATGGTTATATGCCGCCCGTCTTG
18S rRNA
GenBank AB054678
ITS1&2
GenBank AY046174; GenBank KX951501
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
References
Chen. Morphological and molecular studies in the genus Tremella. Bibliotheca Mycologica (1998), 174: 1-225
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Nel, van der Wal. Mycopathol.Mycol.Appl (1968), 36: 94-96
Kurtzman, Robnett. Phylogenetic relationships among yeasts of the ‘Saccharomyces complex’ determined from multigene sequence analyses. FEMS Yeast Res. (2003), 3: 417-732 DOI: 10.1016/S1567-1356(03)00012-6
Tsui et al.. Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses. FEMS Yeast Res. (2008), 8: 651-659 DOI: 10.1111/j.1567-1364.2007.00342.x
Daniel, Meyer. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int.J.Food Microbiol. (2003), 86: 61-78 DOI: 10.1016/S0168-1605(03)00248-4
Suzuki, Nakase. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol.Cult.Coll. (1998), 14: 49-62
Nel, van der Wal. Mycopathol.Mycol.Appl (1968), 36: 94-96
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito