Condividi
Facebook
Linkedin
Twitter
StampaTaxon Name
Candidozyma haemuli (Uden & Kolip.) Q.M. Wang, Yurkov, Boekhout & F.Y. Bai
Accession number
7356
Form of supply
agar slant
Synonymous
Torulopsis haemulonii van Uden & Kolipinski, Candida haemulonis (van Uden & Kolipinski) S.A. Meyer & Yarrow
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 22991; CBS 5149; DBVPG 6958; IFO 10001; IGC 3025; JCM 3762; NRRL Y-6693
Risk Group
1
GMO
No
Status of the strain
Isotype of Torulopsis haemulonii van Uden & Kolipinski
Isolation source
gut of Haemulon siurus, blue-striped grunt fish
Isolation Locality
USA – United States of America
Received from
David Yarrow – The Netherlands – Centraalbureau voor Schimmelcultures (CBS)
Date of deposit
15/09/2002
LSU (D1/D2)
GenBank U44812; Candidozyma_haemuli_DBVPG7356_D1D2
CGCTGCGGCGAGTTGTAGTCTGGAGGTGGCCGGTCCCGGCGCCAGCGCGCAGCCAAGTCC
TTTGGAACAAGGCGCCTGAGAGGGTGACAGCCCCGTGGCAGTTTGTGCTGGTGCCGCCTC
GGCCCACCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATC
TAAAGCTAAATACCGGCGAGAGACCGATAGCGAACAAGTACAGTAATGGAAAGATGAAAA
GCACTTTGAAAAGAGAGTGAAACAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGCACCC
AGACACGGCCTTCTGGCCGGGCCAGCATCGGGTGGGAGGGAGCGACAACGAGCAGTCGAT
GTAGTACAGCCCTCTGGGCTGTGCATTATACGTCTTGCTTTCTGGCTCCTCTCCCGCCCG
AGGACCGCAGCAATAAGGATGCTGGCGCAATGGTTGCAAGCCACCCG
18S rRNA
GenBank AB013572
ITS1&2
GenBank AB118789
Recommended growth temperature
25°C
Recommended growth medium
YPDA (Yeast Extract Peptone Glucose Agar)
Jpapers
Title: Cellular neutral sugar compositions and ubiquinone systems of the genus Candida
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
Authors: Suzuki, Nakase
Journal: Microbiol.Cult.Coll.
Year: 1998
DOI Number: 10.1007/BF02538723
Title: On the intestinal yeast flora of free living hippopotami (Hippopotamus amphibius), wart hogs (Phacochoerus aethiopicus) and bush pigs (Potamochoerus choeropotamus)
Authors: van Uden, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962
Title: On the intestinal yeast flora of free living hippopotami (Hippopotamus amphibius), wart hogs (Phacochoerus aethiopicus) and bush pigs (Potamochoerus choeropotamus)
Authors: van Uden, do Carmo-Sousa
Journal: A.v.Leeuwenhoek
Year: 1962
DOI Number: 10.1016/S0168-1605(03)00248-4
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
Title: Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts
Authors: Daniel, Meyer
Journal: Int.J.Food Microbiol.
Year: 2003
DOI Number: 10.1016/S0723-2020(99)80030-7
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999
Title: Non-universal Usage of the Leucine CUG Codon and the Molecular Phylogeny of the Genus Candida
Authors: Sugita, Nakase
Journal: Syst.Appl.Microbiol.
Year: 1999
DOI Number: 10.1080/13693780310001600435
Title: Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system
Authors: Pryce et al.
Journal: Med.Mycol.
Year: 2003
Title: Rapid identification of fungi by sequencing the ITS1 and ITS2 regions using an automated capillary electrophoresis system
Authors: Pryce et al.
Journal: Med.Mycol.
Year: 2003
DOI Number: 10.1111/j.1567-1364.2007.00342.x
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
Title: Re-examining the phylogeny of clinically relevant Candida species and allied genera based on multigene analyses
Authors: Tsui et al.
Journal: FEMS Yeast Res.
Year: 2008
DOI Number: 10.1128/jcm.31.7.1683-1687.1993
Title: Unrelatedness of groups of yeasts within the Candida haemulonii complex
Authors: Lehmann et al.
Journal: J.Clin.Microbiol.
Year: 1993
Title: Unrelatedness of groups of yeasts within the Candida haemulonii complex
Authors: Lehmann et al.
Journal: J.Clin.Microbiol.
Year: 1993
DOI Number: 10.1128/jcm.35.5.1216-1223.1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Title: Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5\’ end of the large-subunit (26S) ribosomal DNA gene
Authors: Kurtzman, Robnett
Journal: J.Clin.Microbiol.
Year: 1997
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito