Taxon Name
Sporidiobolus salmonicolor Fell & Tallman
Accession number
7998
Form of supply
agar slant
Synonymous
Blastoderma salmonicolor B. Fischer & Brebeck, Sporobolomyces salmonicolor (Fischer & Brebeck) Kluyver & van Niel var. salmonicolor, Aessosporon salmonicolor Van der Walt, Candida kochii (von Wettstein) Basgal, Monilia kochii (von Wettstein) Saccardo, Pro
Restrictions on use
For research use only
Nagoya protocol compliance conditions
Not under the scope of the CBD and the Nagoya protocol
Other Collections numbers
ATCC 36400; CBS 490; DBVPG 6654; IGC 4111; JCM 1841; NCYC 891; NRRL Y-5483; NRRL Y-17301; VKM Y-685; UCD 68-371
Risk Group
1
GMO
No
Status of the strain
Isotype of Sporobolomyces salmonicolor (Fischer & Brebeck) Kluyver & van Niel; Isotype of Sporidiobolus salmonicolor Fell & Statzell Tallman
Isolation source
culture of Torula flavescens
Received from
Marty Miller – USA – University of California – Davis
Date of deposit
25/08/1989
LSU (D1/D2)
GenBank AF070439; Sporobolomyces_salmonicolor_DBVPG7998_D1D2 GTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGCTTTCGGCGTCCGAG
TTGTAATCTCGAGAAGTGTTTTCCGCGTCAGACCGCACACAAGTCTCCTGGAACGGAGCG
TCACAGTGGTGAGAACCCAGTACACGGTGCGGATGCCTGATGCTTTGTGATACACTTTCG
AAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAA
ATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGG
AAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTA
TTCGGAGCTTGCTTCGATTCGCAGGCCCGCATCAGTTTTCCGGGGCGGAAAATCGTAAGG
AGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTTTACTGGATTCGTCCTGGGGGACTGAG
GAACGCAGCGTGCTTTTTGCATGGGCTTCGGCCCATCCACGCTTAGGATGCGGGTGGAAT
GGCTTTAAACGACCCGTCTTGAACCACGGACC
18S rRNA
GenBank AB021697
ITS1&2
GenBank AY015434
Recommended growth temperature
25°C
Recommended growth medium
PDA (Potato Dextrose Agar)
Jpapers
DOI Number: 10.1007/BF00445653
Title: Sympodiomycopsis: a new yeast-like anamorph genus with basidiomycetous nature from orchid nectar
Authors: Sugiyama et al.
Journal: A.v.Leeuwenhoek
Year: 1991
Title: Sympodiomycopsis: a new yeast-like anamorph genus with basidiomycetous nature from orchid nectar
Authors: Sugiyama et al.
Journal: A.v.Leeuwenhoek
Year: 1991
DOI Number: 10.1007/BF01567423
Title: Heterothallism in the basidiomycetous yeast genus Sporidiobolus Nyland
Authors: Fell, Statzell-Tallman
Journal: Curr.Microbiol.
Year: 1981
Title: Heterothallism in the basidiomycetous yeast genus Sporidiobolus Nyland
Authors: Fell, Statzell-Tallman
Journal: Curr.Microbiol.
Year: 1981
DOI Number: 10.1016/S1567-1356(01)00039-3
Title: Recognition of the basidiomycetous yeast Sporobolomyces ruberrimus sp. nov. as a distinct species based on molecular and morphological analyses
Authors: Fell et al.
Journal: FEMS Yeast Res.
Year: 2002
Title: Recognition of the basidiomycetous yeast Sporobolomyces ruberrimus sp. nov. as a distinct species based on molecular and morphological analyses
Authors: Fell et al.
Journal: FEMS Yeast Res.
Year: 2002
DOI Number: 10.1023/A:1001714104005
Title: Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses
Authors: Fell et al.
Journal: A.v.Leeuwenhoek
Year: 1998
Title: Validation of the basidiomycetous yeast, Sporidiobolus microsporus sp. nov., based on phenotypic and molecular analyses
Authors: Fell et al.
Journal: A.v.Leeuwenhoek
Year: 1998
DOI Number: 10.1099/00207713-50-3-1373
Title: Phylogenetic analysis of the ballistoconidium-forming yeast genus Sporobolomyces based on 18S rDNA sequences
Authors: Hamamoto, Nakase
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
Title: Phylogenetic analysis of the ballistoconidium-forming yeast genus Sporobolomyces based on 18S rDNA sequences
Authors: Hamamoto, Nakase
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2000
DOI Number: 10.1099/ijs.0.03037-0
Title: Curvibasidium cygneicollum gen. nov., sp. nov. and Curvibasidium pallidicorallinum sp. nov., novel taxa in the microbotryomycetidae (Urediniomycetes), and their relationship with Rhodotorula fujisanensis and Rhodotorula nothofagi
Authors: Sampaio et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2004
Title: Curvibasidium cygneicollum gen. nov., sp. nov. and Curvibasidium pallidicorallinum sp. nov., novel taxa in the microbotryomycetidae (Urediniomycetes), and their relationship with Rhodotorula fujisanensis and Rhodotorula nothofagi
Authors: Sampaio et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2004
DOI Number: 10.1099/ijs.0.63322-0
Title: Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina
Authors: Libkind et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2009
Title: Sporidiobolus longiusculus sp. nov. and Sporobolomyces patagonicus sp. nov., novel yeasts of the Sporidiobolales isolated from aquatic environments in Patagonia, Argentina
Authors: Libkind et al.
Journal: Int.J.Syst.Evol.Microbiol.
Year: 2009
DOI Number: 10.1128/JCM.39.11.4042-4051.2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
Title: Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts
Authors: Chen et al
Journal: J.Clin.Microbiol.
Year: 2001
DOI Number: 10.1139/w99-020
Title: Utilization of low molecular weight aromatic compounds by heterobasidiomycetous yeasts: Taxonomic implications
Authors: Sampaio
Journal: Can.J.Microbiol.
Year: 1999
Title: Utilization of low molecular weight aromatic compounds by heterobasidiomycetous yeasts: Taxonomic implications
Authors: Sampaio
Journal: Can.J.Microbiol.
Year: 1999
Richiedi informazioni
Inserisci i tuoi dati per ricevere informazioni su questo lievito
